pAAV-H2B-tdTomato-SRT
              
              
                (Plasmid
                
                #203393)
              
            
            
            
          - 
            PurposeAAV transfer plasmid containing H2B fused piggyBac self-reporting transposon with tdTomato marker for mammalian calling cards
- 
              Depositing Labs
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203393 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneUnknown
- Total vector size (bp) 6971
- 
              Vector typeMammalian Expression, AAV
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameH2B fused piggyBac tdTomato self-reporting transposon
- 
                    SpeciesSynthetic
- 
                  Insert Size (bp)3812
- Promoter Ef1a
- 
    
        Tags
        / Fusion Proteins
    - H2B (N terminal on insert)
- 3X SV40 (C terminal on insert)
 
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tcaagcctcagacagtggttc (Common Sequencing Primers)
Resource Information
- 
            Article Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.07.544098v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pAAV-H2B-tdTomato-SRT was a gift from Joseph Dougherty & Rob Mitra (Addgene plasmid # 203393 ; http://n2t.net/addgene:203393 ; RRID:Addgene_203393)
- 
                For your References section: Calling Cards: A Customizable Platform to Longitudinally Record Protein-DNA Interactions Over Time in Cells and Tissues. Yen A, Mateusiak C, Sarafinovska S, Gachechiladze MA, Guo J, Chen X, Moudgil A, Cammack AJ, Hoisington-Lopez J, Crosby M, Brent MR, Mitra RD, Dougherty JD. Curr Protoc. 2023 Sep;3(9):e883. doi: 10.1002/cpz1.883. 10.1002/cpz1.883 PubMed 37755132
