pMZ2007
(Plasmid
#204399)
-
PurposeA 3OC6-HSL sensor for B. subtilis on a shuttle vector for B. subtilis and E. coli.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepNH4
- Backbone size w/o insert (bp) 6429
- Total vector size (bp) 8210
-
Modifications to backboneThis is a shuttle vector containing AmyE homologous arms for integration into B. subtilis genome.
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionschloramphenicol ( 5 µg/ml) resistant when integrated to B. subtilis genome
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namequorum sensing regulator LuxR
-
Insert Size (bp)752
- Promoter PftsH
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer NULL
- 3′ sequencing primer AGATCTTCATCACCGAAACGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGFP
-
Insert Size (bp)717
- Promoter Synthetic promoter PLux0002
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GACAAATCCGCCGCTCTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMZ2007 was a gift from Lauren Andrews (Addgene plasmid # 204399 ; http://n2t.net/addgene:204399 ; RRID:Addgene_204399) -
For your References section:
Synthetic Homoserine Lactone Sensors for Gram-Positive Bacillus subtilis Using LuxR-Type Regulators. Zeng M, Sarker B, Howitz N, Shah I, Andrews LB. ACS Synth Biol. 2023 Dec 11. doi: 10.1021/acssynbio.3c00504. 10.1021/acssynbio.3c00504 PubMed 38079538