Skip to main content

pPV-Dual_promoter-EF1α-2xNLS-Cascade+Cas3-P (RD)
(Plasmid #204619)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204619 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPV
  • Backbone size w/o insert (bp) 8900
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas7, Cas5, Cas8, Cas11, Cas6, and Cas3
  • Species
    E. coli
  • Insert Size (bp)
    7000
  • Promoter EF1a
  • Tag / Fusion Protein
    • Each protein has C- and N-terminal SV40 NLS (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CAAATTATACTTATTAGTCAGTC
  • 3′ sequencing primer GGTGAGATCTGAATCCAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPV-Dual_promoter-EF1α-2xNLS-Cascade+Cas3-P (RD) was a gift from Akitsu Hotta (Addgene plasmid # 204619 ; http://n2t.net/addgene:204619 ; RRID:Addgene_204619)
  • For your References section:

    CRISPR-Cas3 induces broad and unidirectional genome editing in human cells. Morisaka H, Yoshimi K, Okuzaki Y, Gee P, Kunihiro Y, Sonpho E, Xu H, Sasakawa N, Naito Y, Nakada S, Yamamoto T, Sano S, Hotta A, Takeda J, Mashimo T. Nat Commun. 2019 Dec 6;10(1):5302. doi: 10.1038/s41467-019-13226-x. 10.1038/s41467-019-13226-x PubMed 31811138