pcDNA-puro-kozak-scFv-GCN4-HAtag-msfGFP(V206K)-GBI
(Plasmid
#205162)
-
Purposeexpress scFv-GCN4-HAtag-msfGFP(V206K)-GBI
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 205162 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA
- Total vector size (bp) 6926
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namescFv-GCN4-HAtag-msfGFP(V206K)-GBI
-
SpeciesSynthetic
-
Insert Size (bp)1756
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe scFv-GCN4-HAtag-sfGFP-GBI was amplified from Addgene plasmid #60907 and V206K mutation was performed to sfGFP
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA-puro-kozak-scFv-GCN4-HAtag-msfGFP(V206K)-GBI was a gift from Weirui Ma (Addgene plasmid # 205162 ; http://n2t.net/addgene:205162 ; RRID:Addgene_205162) -
For your References section:
Enhanced single RNA imaging reveals dynamic gene expression in live animals. Hu Y, Xu J, Gao E, Fan X, Wei J, Ye B, Xu S, Ma W. Elife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. 10.7554/eLife.82178 PubMed 36867026