2xMARS
(Plasmid
#205233)
-
PurposeExpresses two repeats of PLEKHA5 aa 143-271 (K163A and R164A) fused to mScarlet-iin mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 205233 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemScarlet-i-N1
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5580
-
Modifications to backboneAdded a nuclear export signal downstream of mScarlet-i
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametwo repeats of PLEKHA5 aa 143-271 with K163A and R164A mutations
-
Alt namePEPP2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)834
-
Mutationamino acids 143-271 of PLEKHA5 (GenBank reference sequence NM_001256470.2) with K163A and R164A mutations
-
GenBank IDNM_001256470.2
-
Entrez GenePLEKHA5 (a.k.a. PEPP-2, PEPP2)
- Promoter CMV
-
Tags
/ Fusion Proteins
- mScarlet-i (C terminal on backbone)
- Nuclear Export Sequence (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV forward
- 3′ sequencing primer EGFPC1R (CATTTTATGTTTCAGGTTCAGGG)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
2xMARS was a gift from Jeremy Baskin (Addgene plasmid # 205233 ; http://n2t.net/addgene:205233 ; RRID:Addgene_205233)