Skip to main content

2xMARS
(Plasmid #205233)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205233 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    mScarlet-i-N1
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5580
  • Modifications to backbone
    Added a nuclear export signal downstream of mScarlet-i
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    two repeats of PLEKHA5 aa 143-271 with K163A and R164A mutations
  • Alt name
    PEPP2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    834
  • Mutation
    amino acids 143-271 of PLEKHA5 (GenBank reference sequence NM_001256470.2) with K163A and R164A mutations
  • GenBank ID
    NM_001256470.2
  • Entrez Gene
    PLEKHA5 (a.k.a. PEPP-2, PEPP2)
  • Promoter CMV
  • Tags / Fusion Proteins
    • mScarlet-i (C terminal on backbone)
    • Nuclear Export Sequence (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV forward
  • 3′ sequencing primer EGFPC1R (CATTTTATGTTTCAGGTTCAGGG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    2xMARS was a gift from Jeremy Baskin (Addgene plasmid # 205233 ; http://n2t.net/addgene:205233 ; RRID:Addgene_205233)
  • For your References section:

    A phosphorylation-controlled switch confers cell cycle-dependent protein relocalization. Cao X, Huang S, Wagner MM, Cho YT, Chiu DC, Wartchow KM, Lazarian A, McIntire LB, Smolka MB, Baskin JM. Nat Cell Biol. 2024 Oct;26(10):1804-1816. doi: 10.1038/s41556-024-01495-8. Epub 2024 Aug 29. 10.1038/s41556-024-01495-8 PubMed 39209962