Skip to main content
Addgene

AAV-LK03
(Plasmid #206512)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206512 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAV2 rep, partial p5 in generic backbone
  • Backbone size w/o insert (bp) 5119
  • Total vector size (bp) 7330
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable ;
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LK03 capsid
  • Species
    adeno-associated virus
  • Insert Size (bp)
    2211
  • Promoter p5

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Swa I (not destroyed)
  • 3′ cloning site Age I (not destroyed)
  • 5′ sequencing primer TGGATGACTGCATCTTTGAA
  • 3′ sequencing primer GCAGGTTTAAACGAATTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-LK03 was a gift from Mark Kay (Addgene plasmid # 206512 ; http://n2t.net/addgene:206512 ; RRID:Addgene_206512)
  • For your References section:

    Selection and evaluation of clinically relevant AAV variants in a xenograft liver model. Lisowski L, Dane AP, Chu K, Zhang Y, Cunningham SC, Wilson EM, Nygaard S, Grompe M, Alexander IE, Kay MA. Nature. 2014 Feb 20;506(7488):382-6. doi: 10.1038/nature12875. Epub 2013 Dec 25. 10.1038/nature12875 PubMed 24390344