Skip to main content

LAMP1-mCherry-FRB*
(Plasmid #207145)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207145 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 6263
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LAMP1
  • Alt name
    Lysosome associated membrane protein 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1251
  • Mutation
    Silent mutation
  • GenBank ID
    3916
  • Entrez Gene
    LAMP1 (a.k.a. CD107a, LAMPA, LGP120)
  • Promoter CMV
  • Tags / Fusion Proteins
    • mCherry (C terminal on insert)
    • FRB* (T2098L mutant of FKBP-rapamycin binding domain) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CAACGGGACTTTCCAAAATG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LAMP1-mCherry-FRB* was a gift from Antony Galione (Addgene plasmid # 207145 ; http://n2t.net/addgene:207145 ; RRID:Addgene_207145)
  • For your References section:

    NAADP-regulated two-pore channels drive phagocytosis through endo-lysosomal Ca(2+) nanodomains, calcineurin and dynamin. Davis LC, Morgan AJ, Galione A. EMBO J. 2020 Jul 15;39(14):e104058. doi: 10.15252/embj.2019104058. Epub 2020 Jun 8. 10.15252/embj.2019104058 PubMed 32510172