pTRE-BI-TRIM21
(Plasmid
#207838)
-
PurposeInducible TRIM21 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207838 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneVB190904-1039fwc
-
Backbone manufacturerVectorBuilder
- Backbone size w/o insert (bp) 6768
- Total vector size (bp) 10019
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAlthough the plasmid is expressed from a "high-copy" ORI, the amounts of plasmid recovered from conventional plasmid preparations are relatively low (possibly due to the size and/or complexity of the plasmid).
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTRIM21
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1425
-
Entrez GeneTRIM21 (a.k.a. RNF81, RO52, Ro/SSA, SSA, SSA1)
- Promoter TRE3G BI promoter
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGAGGCTAGTCTCGTGATC
- 3′ sequencing primer AAGCGCATGAACTCCTTGATGATG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
Insert Size (bp)732
- Promoter TRE3G BI promoter
-
Tag
/ Fusion Protein
- weak NLS (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cactctggatccagacaca
- 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namehIgG1-FC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)204
- Promoter TRE3G BI promoter
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTACCCTCGTAAACCGC
- 3′ sequencing primer AAAGGACAGTGGGAGTGG
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameVHH-GFP4
-
Alt nameanti GFP Nanobody
-
SpeciesSynthetic
-
Insert Size (bp)354
-
MutationAll K mutated to R
- Promoter TRE3G BI promoter
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTACCCTCGTAAACCGC
- 3′ sequencing primer AAAGGACAGTGGGAGTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE-BI-TRIM21 was a gift from Michaela Mueller-McNicoll (Addgene plasmid # 207838 ; http://n2t.net/addgene:207838 ; RRID:Addgene_207838) -
For your References section:
hGRAD: A versatile "one-fits-all" system to acutely deplete RNA binding proteins from condensates. Arnold B, Riegger RJ, Okuda EK, Sliskovic I, Keller M, Bakisoglu C, McNicoll F, Zarnack K, Muller-McNicoll M. J Cell Biol. 2024 Feb 5;223(2):e202304030. doi: 10.1083/jcb.202304030. Epub 2023 Dec 18. 10.1083/jcb.202304030 PubMed 38108808