GW1-mScarlet-Epac-GeNL
(Plasmid
#207874)
-
PurposeMammalian expression of the FRET/BRET cAMP sensor
-
Depositing Lab
-
Depositing OrganizationPurdue University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 207874-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 207874-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneGW1
- Backbone size w/o insert (bp) 4461
- Total vector size (bp) 9362
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemScarlet-hEpac1(149-881)-mNeonGreen-NanoLuc
-
Alt namemScarlet-hEpac1(149-881)-GeNL
-
SpeciesSynthetic
-
Insert Size (bp)4092
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGAATCGGAGTGAGTGC
- 3′ sequencing primer CAAATGTGGTATGGCTGATT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 207874-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 207874-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GW1-mScarlet-Epac-GeNL was a gift from Mathew Tantama (Addgene plasmid # 207874 ; http://n2t.net/addgene:207874 ; RRID:Addgene_207874) -
For your References section:
Dual-Mode FRET and BRET Sensors for Detecting cAMP Dynamics. French AR, Tesmer AL, Tantama M. ACS Omega. 2019 Sep 12;4(13):15504-15511. doi: 10.1021/acsomega.9b01770. eCollection 2019 Sep 24. 10.1021/acsomega.9b01770 PubMed 31572851