pSC101-GFPmut2-mScarlet-I TGATC
(Plasmid
#208190)
-
Purposenonsense mistranslation, TGA stop variant 2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSC101
- Backbone size w/o insert (bp) 3968
- Total vector size (bp) 5626
-
Vector typeBacterial Expression ; reporter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameGFPmut2
-
SpeciesSynthetic
-
Insert Size (bp)725
-
GenBank ID
- Promoter Ptet+dnaK P1
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctcatgtttgacagcttatcatcgataagc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemScarlet-I
-
SpeciesSynthetic
-
Insert Size (bp)702
-
MutationInsertion 6TGA*(stop) 7TCT(Ser)
-
GenBank ID
- Promoter Ptet+dnaK P1
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ACATGGTCCTTCTTGAGTTTGTAACAGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSC101-GFPmut2-mScarlet-I TGATC was a gift from Tanel Tenson (Addgene plasmid # 208190 ; http://n2t.net/addgene:208190 ; RRID:Addgene_208190) -
For your References section:
Fluorescent reporters give new insights into antibiotics-induced nonsense and frameshift mistranslation. Hinnu M, Putrins M, Kogermann K, Kaldalu N, Tenson T. Sci Rep. 2024 Mar 22;14(1):6883. doi: 10.1038/s41598-024-57597-8. 10.1038/s41598-024-57597-8 PubMed 38519558