Skip to main content

pCMV enAsCas12f-YHAM-sgRNA_v7
(Plasmid #208356)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208356 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV-AsCas12f1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    enAsCas12f-YHAM
  • Alt name
    Cas12U3
  • Species
    Synthetic
  • Mutation
    F48Y/S188H/V232A/E316M
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GCGATGCAATTTCCTCATTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV enAsCas12f-YHAM-sgRNA_v7 was a gift from Atsushi Hoshino (Addgene plasmid # 208356 ; http://n2t.net/addgene:208356 ; RRID:Addgene_208356)
  • For your References section:

    An AsCas12f-based compact genome-editing tool derived by deep mutational scanning and structural analysis. Hino T, Omura SN, Nakagawa R, Togashi T, Takeda SN, Hiramoto T, Tasaka S, Hirano H, Tokuyama T, Uosaki H, Ishiguro S, Kagieva M, Yamano H, Ozaki Y, Motooka D, Mori H, Kirita Y, Kise Y, Itoh Y, Matoba S, Aburatani H, Yachie N, Karvelis T, Siksnys V, Ohmori T, Hoshino A, Nureki O. Cell. 2023 Sep 22:S0092-8674(23)00963-7. doi: 10.1016/j.cell.2023.08.031. 10.1016/j.cell.2023.08.031 PubMed 37776859