Skip to main content

pSLQ11274:pHR-hU6-crTet-HSP-hyperdCas12a-miniVPR-CMV-mCherry
(Plasmid #210603)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210603 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Backbone size w/o insert (bp) 5842
  • Total vector size (bp) 13578
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hyperdCas12a-miniVPR
  • Insert Size (bp)
    7736
  • Promoter truncated hsp70

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AATTCTACCACTGAACCACC
  • 3′ sequencing primer gtgcttcacgctggtctgggcgtac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ11274:pHR-hU6-crTet-HSP-hyperdCas12a-miniVPR-CMV-mCherry was a gift from Stanley Qi (Addgene plasmid # 210603 ; http://n2t.net/addgene:210603 ; RRID:Addgene_210603)
  • For your References section:

    Sonogenetic control of multiplexed genome regulation and base editing. Liu P, Foiret J, Situ Y, Zhang N, Kare AJ, Wu B, Raie MN, Ferrara KW, Qi LS. Nat Commun. 2023 Oct 18;14(1):6575. doi: 10.1038/s41467-023-42249-8. 10.1038/s41467-023-42249-8 PubMed 37852951