Skip to main content

Brachyury-eGFP
(Plasmid #21063)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21063 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    SIN18
  • Backbone size w/o insert (bp) 5461
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Brachyury promoter
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    644
  • Tag / Fusion Protein
    • eGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site claI (not destroyed)
  • 3′ cloning site ageI (not destroyed)
  • 5′ sequencing primer CTTGATGCCGTTCTTCTGCTT - 3' sequencing only
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Brachyury-eGFP was a gift from Mark Mercola (Addgene plasmid # 21063 ; http://n2t.net/addgene:21063 ; RRID:Addgene_21063)
  • For your References section:

    Lentiviral vectors and protocols for creation of stable hESC lines for fluorescent tracking and drug resistance selection of cardiomyocytes. Kita-Matsuo H, Barcova M, Prigozhina N, Salomonis N, Wei K, Jacot JG, Nelson B, Spiering S, Haverslag R, Kim C, Talantova M, Bajpai R, Calzolari D, Terskikh A, McCulloch AD, Price JH, Conklin BR, Chen HS, Mercola M. PLoS ONE. 2009 . 4(4):e5046. 10.1371/journal.pone.0005046 PubMed 19352491