Skip to main content

Talin1 head-mCherry
(Plasmid #212005)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212005 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3962
  • Total vector size (bp) 6143
  • Modifications to backbone
    N-terminal EGFP removed
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mouse talin1 head domain (1-490)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2181
  • GenBank ID
    CAA39588.1
  • Entrez Gene
    Tln1 (a.k.a. Tln)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry fluorescent protein (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer acgcaaatgggcggtagg
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Talin1 head-mCherry was a gift from Vesa Hytönen (Addgene plasmid # 212005 ; http://n2t.net/addgene:212005 ; RRID:Addgene_212005)
  • For your References section:

    Talin-mediated force transmission and talin rod domain unfolding independently regulate adhesion signaling. Rahikainen R, Ohman T, Turkki P, Varjosalo M, Hytonen VP. J Cell Sci. 2019 Apr 3;132(7):jcs226514. doi: 10.1242/jcs.226514. 10.1242/jcs.226514 PubMed 30837291