pBK-Ma pylRS nitroY/haloY-F5
(Plasmid
#212125)
-
PurposeExpresses Methanomethylophilus alvus pyrrolysine tRNA synthetase engineered for 3-nitroY and 3-haloY under GlnS promoter. Used as a control for Ma Pyl tRNA-synthetase selections.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212125 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBK
- Backbone size w/o insert (bp) 2012
- Total vector size (bp) 2854
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameM. alvus PylRS 3-NY/HaloY F5
-
Alt nameNYF5
-
SpeciesMethanomethylophilus alvus
-
MutationCTG125CTT, N166A V168S, A223C, W239R
- Promoter GlnS (constitutive)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer tgctgagttgaaggatcctcgg
- 3′ sequencing primer gtgaacgccttatccggcctac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Expresses Methanomethylophilus alvus pyrrolysine tRNA synthetase (MaRS) engineered for 3-nitrotyrosine and 3-halotryosines under GlnS promoter. Used as a control for Ma Pyl tRNA-synthetase selections. This plasmid expresses the Ma RS only and must be paired with a cognate Ma tRNA as well as gene of interest.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBK-Ma pylRS nitroY/haloY-F5 was a gift from Ryan Mehl (Addgene plasmid # 212125 ; http://n2t.net/addgene:212125 ; RRID:Addgene_212125)