Skip to main content

pBK-Ma pylRS nitroY/haloY-F5
(Plasmid #212125)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212125 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBK
  • Backbone size w/o insert (bp) 2012
  • Total vector size (bp) 2854
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    M. alvus PylRS 3-NY/HaloY F5
  • Alt name
    NYF5
  • Species
    Methanomethylophilus alvus
  • Mutation
    CTG125CTT, N166A V168S, A223C, W239R
  • Promoter GlnS (constitutive)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer tgctgagttgaaggatcctcgg
  • 3′ sequencing primer gtgaacgccttatccggcctac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expresses Methanomethylophilus alvus pyrrolysine tRNA synthetase (MaRS) engineered for 3-nitrotyrosine and 3-halotryosines under GlnS promoter. Used as a control for Ma Pyl tRNA-synthetase selections. This plasmid expresses the Ma RS only and must be paired with a cognate Ma tRNA as well as gene of interest.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBK-Ma pylRS nitroY/haloY-F5 was a gift from Ryan Mehl (Addgene plasmid # 212125 ; http://n2t.net/addgene:212125 ; RRID:Addgene_212125)