pLKO5.U6.DR130(CasRX)_GFP-targeting sgRNA.EFS.tRFP657
(Plasmid
#212963)
-
PurposeLentiviral plasmid for the measurement of RfxCas13d (CasRx) nuclease activity. As a marker, the plasmid also encodes the tRFP657 fluorescence protein.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO.005
- Total vector size (bp) 7358
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersTagRFP657
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDR1_CasRx_GFP targeting spacer
- Promoter U6
-
Tag
/ Fusion Protein
- TagRFP657
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer ACGATACAAGGCTGTTAGAGAG
- 3′ sequencing primer N/A (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO5.U6.DR130(CasRX)_GFP-targeting sgRNA.EFS.tRFP657 was a gift from Roland Rad (Addgene plasmid # 212963 ; http://n2t.net/addgene:212963 ; RRID:Addgene_212963) -
For your References section:
Genome-scale pan-cancer interrogation of lncRNA dependencies using CasRx. Montero JJ, Trozzo R, Sugden M, Ollinger R, Belka A, Zhigalova E, Waetzig P, Engleitner T, Schmidt-Supprian M, Saur D, Rad R. Nat Methods. 2024 Feb 26. doi: 10.1038/s41592-024-02190-0. 10.1038/s41592-024-02190-0 PubMed 38409225