Skip to main content

pcVpx.myc
(Plasmid #213388)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213388 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA6
  • Total vector size (bp) 5438
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Depositing lab also uses HB101 E. coli for transformation.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SIVmac vpx
  • Alt name
    Vpx
  • Species
    Simian Immunodeficiency Virus
  • Insert Size (bp)
    336
  • Entrez Gene
    vpx (a.k.a. SIVgp3)
  • Promoter CMV
  • Tag / Fusion Protein
    • myc-6xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (unknown if destroyed)
  • 3′ cloning site Xho1 (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcVpx.myc was a gift from Nathaniel Landau (Addgene plasmid # 213388 ; http://n2t.net/addgene:213388 ; RRID:Addgene_213388)
  • For your References section:

    Human immunodeficiency virus type 1 modified to package Simian immunodeficiency virus Vpx efficiently infects macrophages and dendritic cells. Sunseri N, O'Brien M, Bhardwaj N, Landau NR. J Virol. 2011 Jul;85(13):6263-74. doi: 10.1128/JVI.00346-11. Epub 2011 Apr 20. 10.1128/JVI.00346-11 PubMed 21507971