-
PurposeGenerate lentiviral vector which increases gene delivery into primary human myeloid cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213388 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA6
- Total vector size (bp) 5438
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDepositing lab also uses HB101 E. coli for transformation.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSIVmac vpx
-
Alt nameVpx
-
SpeciesSimian Immunodeficiency Virus
-
Insert Size (bp)336
-
Entrez Genevpx (a.k.a. SIVgp3)
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-6xHis (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (unknown if destroyed)
- 3′ cloning site Xho1 (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcVpx.myc was a gift from Nathaniel Landau (Addgene plasmid # 213388 ; http://n2t.net/addgene:213388 ; RRID:Addgene_213388) -
For your References section:
Human immunodeficiency virus type 1 modified to package Simian immunodeficiency virus Vpx efficiently infects macrophages and dendritic cells. Sunseri N, O'Brien M, Bhardwaj N, Landau NR. J Virol. 2011 Jul;85(13):6263-74. doi: 10.1128/JVI.00346-11. Epub 2011 Apr 20. 10.1128/JVI.00346-11 PubMed 21507971