pMRX-IP-TMEM192-mKeima
(Plasmid
#215358)
-
PurposeProbe to evaluate lysophagic activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215358 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMRX-IP
-
Backbone manufacturerDr. Yamaoka (Tokyo Medical and Dental University, Tokyo, Japan)
- Backbone size w/o insert (bp) 6084
- Total vector size (bp) 7617
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametransmembrane protein 192
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1533
-
GenBank IDNM_001100389.1
-
Entrez GeneTMEM192
-
Tag
/ Fusion Protein
- mKeima (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGTGGTACGGGAATTATGGCGGCGGGGGGCAGG
- 3′ sequencing primer ATTTACGTAGCGGCCTTAACCGAGCAAAGAGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe genes encoding mKeima and TMEM192 were obtained through Addgene plasmids #54597 and #102930, respectively.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please acknowledge Dr. Yamaoka (Tokyo Medical and Dental University, Tokyo, Japan) as the provider of the pMRX-IP vector and, if applicable, cite the original article (PMID: 12459460, DOI: 10.1016/s0014-5793(02)03622-0) in your future publications.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRX-IP-TMEM192-mKeima was a gift from Tamotsu Yoshimori (Addgene plasmid # 215358 ; http://n2t.net/addgene:215358 ; RRID:Addgene_215358) -
For your References section:
The TMEM192-mKeima probe specifically assays lysophagy and reveals its initial steps. Shima T, Ogura M, Matsuda R, Nakamura S, Jin N, Yoshimori T, Kuma A. J Cell Biol. 2023 Dec 4;222(12):e202204048. doi: 10.1083/jcb.202204048. Epub 2023 Oct 6. 10.1083/jcb.202204048 PubMed 37801070