pSfinx-mYFP
(Plasmid
#216206)
-
PurposeA simplified disease resistance assay using YFP-expressing Potato Virus X in N. benthamiana
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216206 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSfinx, derived from pGr106
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemonomeric yellow fluorescent protein
-
Alt namemYFP
-
SpeciesAequorea victoria
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiIA (not destroyed)
- 3′ cloning site SfiIB (not destroyed)
- 5′ sequencing primer GCTTGCAAACTAGATGCAGAAA
- 3′ sequencing primer CTGTGTTGTGCTAGCTGGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For transformation into Agrobacterium, Agrobacterium tumefaciens strain, containing the helper plasmid pSOUP (also known as pSaRep or pIC-SArep) should be used.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSfinx-mYFP was a gift from Takaki Maekawa (Addgene plasmid # 216206 ; http://n2t.net/addgene:216206 ; RRID:Addgene_216206) -
For your References section:
A disease resistance assay in Nicotiana benthamiana reveals the immune function of Response to HopBA1. Hasegawa K, Timmers T, Chai J, Maekawa T. Plant Physiol. 2024 Jul 8:kiae368. doi: 10.1093/plphys/kiae368. 10.1093/plphys/kiae368 PubMed 38976586