CROPseq-multi-Zeo (pRW1445)
(Plasmid
#216218)
-
Purpose(Empty Backbone) Entry vector to clone sgRNA(s) into the CROPseq-multi construct with Zeocin resistance
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216218 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneCROPseq-puro-v2 (Plasmid #127458)
- Backbone size (bp) 10421
-
Modifications to backboneLenti promoter changed to CMV
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGGCTAATTCACTCCCAACGAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2024.03.17.585235v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CROPseq-multi-Zeo (pRW1445) was a gift from Paul Blainey (Addgene plasmid # 216218 ; http://n2t.net/addgene:216218 ; RRID:Addgene_216218) -
For your References section:
CROPseq-multi: a versatile solution for multiplexed perturbation and decoding in pooled CRISPR screens. Walton RT, Qin Y, Blainey PC. bioRxiv 2024.03.17.585235 10.1101/2024.03.17.585235