pAAV/EF1a-DIO-SCLM
(Plasmid
#216759)
-
PurposeAAV2 transfer vector for Cre recombinase-dependent expression of SuperClomeleon from the human elongation factor 1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-Ef1a-DIO SwiChRca-TS-EYFP
-
Backbone manufacturerKarl Deisseroth (Addgene plasmid # 55631)
- Backbone size w/o insert (bp) 5343
- Total vector size (bp) 6729
-
Modifications to backboneThe human growth hormone polyA terminator was replaced by the shorter bovine one.
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuperClomeleon
-
Alt nameCerulean/S30R/dC11-LE-Topaz/dN5/S30R/Q69T/V163A
-
SpeciesA. victoria (crystal jelly)
-
Insert Size (bp)1386
-
MutationS30R and 11 AA deletion in the Cerulean CFP moiety and 5 AA deletion, S30R, Q69T, and V163A in the Topaz YFP moiety
- Promoter EF1a (human elongation factor 1 alpha)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer tcaagcctcagacagtggttc
- 3′ sequencing primer agccatacgggaagcaatagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV/EF1a-DIO-SCLM was a gift from George Augustine (Addgene plasmid # 216759 ; http://n2t.net/addgene:216759 ; RRID:Addgene_216759)