hSirt3-RFP
(Plasmid
#216806)
-
PurposeHuman Sirt3-RFP driven by the CaMKII promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216806 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFCK(1.3)GW
- Backbone size w/o insert (bp) 9239
- Total vector size (bp) 11141
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin ; bleomycin and phleomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSirt3
-
Alt namesirtuin 3
-
Alt nameNAD-dependent protein deacetylase sirtuin-3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1902
-
GenBank ID
-
Entrez GeneSIRT3 (a.k.a. SIR2L3)
- Promoter CamKII
-
Tag
/ Fusion Protein
- mRFP1 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site Age1 (not destroyed)
- 5′ sequencing primer GAGGCTGTGAGCAGCCACAG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hSirt3-RFP was a gift from Ghazaleh Ashrafi (Addgene plasmid # 216806 ; http://n2t.net/addgene:216806 ; RRID:Addgene_216806) -
For your References section:
Sirtuin3 ensures the metabolic plasticity of neurotransmission during glucose deprivation. Tiwari A, Hashemiaghdam A, Laramie MA, Maschi D, Haddad T, Stunault MI, Bergom C, Javaheri A, Klyachko V, Ashrafi G. J Cell Biol. 2024 Jan 1;223(1):e202305048. doi: 10.1083/jcb.202305048. Epub 2023 Nov 21. 10.1083/jcb.202305048 PubMed 37988067