Skip to main content

gCH29 (crCD81-1)
(Plasmid #217344)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217344 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRG212
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    crCD81-1
  • gRNA/shRNA sequence
    ggcgcgacccccaggaaggtctc
  • Species
    H. sapiens (human)
  • Entrez Gene
    CD81 (a.k.a. CVID6, S5.7, TAPA1, TSPAN28)
  • Promoter hU6

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gCH29 (crCD81-1) was a gift from Luke Gilbert (Addgene plasmid # 217344 ; http://n2t.net/addgene:217344 ; RRID:Addgene_217344)
  • For your References section:

    Engineered CRISPR-Cas12a for higher-order combinatorial chromatin perturbations. Hsiung CC, Wilson CM, Sambold NA, Dai R, Chen Q, Teyssier N, Misiukiewicz S, Arab A, O'Loughlin T, Cofsky JC, Shi J, Gilbert LA. Nat Biotechnol. 2024 May 17. doi: 10.1038/s41587-024-02224-0. 10.1038/s41587-024-02224-0 PubMed 38760567