pAAV-TetON-Bmpr1A-ca
(Plasmid
#217536)
-
PurposeAAV vector to drive the expression of Cre- and doxycycline-dependent expression of HA-epitope tagged constitutively-active BMPR1A receptor
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameconstitutively active BMP receptor 1a
-
Alt namecaBMPR1a
-
SpeciesH. sapiens (human)
-
Entrez GeneBMPR1A (a.k.a. 10q23del, ACVRLK3, ALK-3, ALK3, BMPR-1A, CD292, SKR5)
- Promoter Tet operon (TetO)
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site SphI (not destroyed)
- 5′ sequencing primer CACCACGCGAGGCGCGAGATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TetON-Bmpr1A-ca was a gift from Peter Scheiffele (Addgene plasmid # 217536 ; http://n2t.net/addgene:217536 ; RRID:Addgene_217536) -
For your References section:
Control of neuronal excitation-inhibition balance by BMP-SMAD1 signaling. Okur Z, Schlauri N, Bitsikas V, Panopoulou M, Karmakar K, Schreiner D, Scheiffele P. bioRxiv 2023 10.1101/2023.03.11.532164