pOET5 GII.4 Sydney noro-VLP
(Plasmid
#218092)
-
PurposeForms Sydney GII.4 Sydney norovirus-like particle in insect cells by expression of VP1 from strain GII.4/Sydney/NSW0514/2012/AU (GenBank ID: AFV08795).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218092 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepOET5.1
-
Backbone manufacturerOxford Expression Technologies
- Backbone size w/o insert (bp) 4553
- Total vector size (bp) 6176
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenoro-VLP
-
Alt namenoro-VP1
-
Alt nameWT-noro-VLP
-
Alt nameVP1
-
SpeciesH. sapiens (human); Human norovirus
-
Insert Size (bp)1623
-
GenBank IDAFV08795
- Promoter Polyhedrin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TTTCGTAACAGTTTTGTAATAAAAAAACCTA
- 3′ sequencing primer ACACGATACATTGTTATTAGTACATTTAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGene synthetically produced and cloned by GenScript.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOET5 GII.4 Sydney noro-VLP was a gift from Minna Hankaniemi (Addgene plasmid # 218092 ; http://n2t.net/addgene:218092 ; RRID:Addgene_218092)