pOET5 CVB3-VLP
(Plasmid
#218146)
-
PurposeForms coxsackievirus 3-like particle in insect cells by expression of VP1–VP4 polyprotein (GeneID M33854.1) and 3CD protease (GeneID M33854.1).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepOET5.1
-
Backbone manufacturerOxford Expression Technologies
- Backbone size w/o insert (bp) 5203
- Total vector size (bp) 9709
-
Modifications to backboneP10 promoter replaced with CMV enhancer and promoter
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameVP1–VP4
-
Alt nameEnterovirus polyprotein
-
Alt nameCoxsackievirus polyprotein
-
Alt nameCVB3 polyprotein
-
SpeciesH. sapiens (human); Coxsackievirus B3
-
Insert Size (bp)2565
-
GenBank IDM33854.1
- Promoter Polyhedrin
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GATAATTAAAATGATAACCATC
- 3′ sequencing primer TATAATCTTTAGGGTGGTATGTTAGAGCGA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert name3CD
-
Alt name3CD protease
-
Alt nameenterovirus protease
-
Alt nameCVB3 3CD protease
-
SpeciesH. sapiens (human); Coxsackievirus B3
-
Insert Size (bp)1941
-
GenBank IDM33854.1
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer CCCTTGCTGTCCTGCCCCACCCCACCCCC
- 3′ sequencing primer ATTTTGGTGCCAAAACAAACTCCCATTGACGTCAATGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGene synthetically produced and cloned by GenScript.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOET5 CVB3-VLP was a gift from Minna Hankaniemi (Addgene plasmid # 218146 ; http://n2t.net/addgene:218146 ; RRID:Addgene_218146)