-
Purpose(Empty Backbone) Cre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSicoR
- Backbone size (bp) 7558
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer cacagacttgtgggagaagc
- 3′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSicoR-mCh-empty was a gift from Miguel Ramalho-Santos (Addgene plasmid # 21907 ; http://n2t.net/addgene:21907 ; RRID:Addgene_21907) -
For your References section:
Chd1 regulates open chromatin and pluripotency of embryonic stem cells. Gaspar-Maia A, Alajem A, Polesso F, Sridharan R, Mason MJ, Heidersbach A, Ramalho-Santos J, McManus MT, Plath K, Meshorer E, Ramalho-Santos M. Nature. 2009 Aug 13;460(7257):863-8. doi: 10.1038/nature08212. Epub 2009 Jul 8. 10.1038/nature08212 PubMed 19587682