EF1a-L274GMmMetRS-T2A-mCherry
(Plasmid
#220800)
-
PurposeLentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 220800 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLJM1-EGFP
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 9651
-
Modifications to backboneInserted EF1a-L274GMmMetRS-mCherry plus hPGK-PuroR, removed GFP
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMars1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3493
-
Mutationmutation in MetRS to change aa 274 from L to G
-
GenBank IDNM_001003913
-
Entrez GeneMars1 (a.k.a. Mars, Metrs, Mtrns)
- Promoter EF1a
-
Tags
/ Fusion Proteins
- T2A-mCherry (C terminal on insert)
- 2xFLAG (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EF1a-L274GMmMetRS-T2A-mCherry was a gift from Elizabeth Kirby (Addgene plasmid # 220800 ; http://n2t.net/addgene:220800 ; RRID:Addgene_220800) -
For your References section:
Bioorthogonal non-canonical amino acid tagging to track transplanted human induced pluripotent stem cell-specific proteome. Sridharan D, Dougherty JA, Ahmed U, Sanghvi SK, Alvi SB, Park KH, Islam H, Knoblaugh SE, Singh H, Kirby ED, Khan M. Stem Cell Res Ther. 2024 Jun 26;15(1):186. doi: 10.1186/s13287-024-03792-3. 10.1186/s13287-024-03792-3 PubMed 38926849