pSF18
(Plasmid
#222593)
-
PurposeBB2 ZWF1 tet-on overexpression cassette
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222593 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneBB2_L_AB_syn_BbsI
-
Backbone manufacturerMichael Sauer (Sarkari et al. 2017) Addgene #89917
- Total vector size (bp) 6746
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameZWF1
-
SpeciesPichia Pastoris
-
Insert Size (bp)1516
-
MutationInternal BsaI and BpiI sites removed from insert
- Promoter tet-on
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CATTAATGCAGCTGGCAC
- 3′ sequencing primer GGTTATTGTCTCATGAGCGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSF18 was a gift from Matthias Steiger (Addgene plasmid # 222593 ; http://n2t.net/addgene:222593 ; RRID:Addgene_222593) -
For your References section:
Regulation of the Glucose-6-phosphate dehydrogenase encoding gene gsdA and its impact on growth and citric acid production in Aspergillus niger. Matthias Steiger. PLOS One 10.1371/journal.pone.0321363