Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pQCXIN X2/shp16 (w415-1)
(Plasmid #22271)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 22271 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQCXIN
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7801
  • Vector type
    Retroviral, RNAi
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    TOP10F', 37oC
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA Cyclin-dependent kinase inhibitor 2A (CDKN2A)
  • Alt name
    shp16
  • Insert Size (bp)
    446

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bam HI (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer U6forw
  • 3′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    shp16 was obtained from Dr. Christian Beausejour.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

shRNA oligo sequence is 5'-GACCGTAACTATTCGGTGCGTTGGGCAGAAGCTTGTGCTCAACGCACCGAATAGTTGCGGTCTTTTT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQCXIN X2/shp16 (w415-1) was a gift from Eric Campeau (Addgene plasmid # 22271 ; http://n2t.net/addgene:22271 ; RRID:Addgene_22271)