pQCXIN X2/shp16 (w415-1)
(Plasmid
#22271)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22271 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQCXIN
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7801
-
Vector typeRetroviral, RNAi
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsTOP10F', 37oC
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA Cyclin-dependent kinase inhibitor 2A (CDKN2A)
-
Alt nameshp16
-
Insert Size (bp)446
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bam HI (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer U6forw
- 3′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byshp16 was obtained from Dr. Christian Beausejour.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA oligo sequence is 5'-GACCGTAACTATTCGGTGCGTTGGGCAGAAGCTTGTGCTCAACGCACCGAATAGTTGCGGTCTTTTT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQCXIN X2/shp16 (w415-1) was a gift from Eric Campeau (Addgene plasmid # 22271 ; http://n2t.net/addgene:22271 ; RRID:Addgene_22271)