ICMAB - pET22b T7 EncFtn Mms6
(Plasmid
#225538)
-
PurposeConstruction of intracellular magnetite accumulating bacterial systems.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225538 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET22b
- Backbone size w/o insert (bp) 5289
- Total vector size (bp) 6966
-
Modifications to backboneresistance gene to cmr, pelb removal
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions30 °C for induction
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameIron binding protein
-
Alt nameMms6
-
SpeciesMagnetospirillum magneticum AMB-1 strain
-
Insert Size (bp)396
-
GenBank ID3805266
- Promoter T7
-
Tag
/ Fusion Protein
- no
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CATACCCACGCCGAAACAAG
- 3′ sequencing primer CCTCCTTTCAGCAAAAAACCCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFerroxidase
-
Alt nameEncFtn
-
SpeciesRhodospirillum rubrum
-
Insert Size (bp)330
-
GenBank ID3833453
- Promoter T7
-
Tag
/ Fusion Protein
- no
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CATACCCACGCCGAAACAAG
- 3′ sequencing primer CCTCCTTTCAGCAAAAAACCCC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameMaterial binding peptite
-
Alt nameMBP
-
SpeciesE. coli Nissle 1917
-
Insert Size (bp)36
- Promoter T7
-
Tag
/ Fusion Protein
- no
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CATACCCACGCCGAAACAAG
- 3′ sequencing primer CCTCCTTTCAGCAAAAAACCCC
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameIron transporter protein
-
Alt nameEfeU
-
SpeciesE. coli Nissle 1917
-
Insert Size (bp)831
-
GenBank ID948956
- Promoter T7
-
Tag
/ Fusion Protein
- no
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer CATACCCACGCCGAAACAAG
- 3′ sequencing primer CCTCCTTTCAGCAAAAAACCCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ICMAB - pET22b T7 EncFtn Mms6 was a gift from Urartu Seker (Addgene plasmid # 225538 ; http://n2t.net/addgene:225538 ; RRID:Addgene_225538) -
For your References section:
Engineered Bacteria with Genetic Circuits Accumulating Nanomagnets as MRI Contrast Agents. Yavuz M, Utkur M, Kehribar ES, Yagiz E, Saritas EU, Seker UOS. Small. 2022 Jul;18(26):e2200537. doi: 10.1002/smll.202200537. Epub 2022 May 13. 10.1002/smll.202200537 PubMed 35567331