Skip to main content

ICMAB - pET22b T7 EncFtn Mms6
(Plasmid #225538)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225538 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET22b
  • Backbone size w/o insert (bp) 5289
  • Total vector size (bp) 6966
  • Modifications to backbone
    resistance gene to cmr, pelb removal
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    30 °C for induction
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Iron binding protein
  • Alt name
    Mms6
  • Species
    Magnetospirillum magneticum AMB-1 strain
  • Insert Size (bp)
    396
  • GenBank ID
    3805266
  • Promoter T7
  • Tag / Fusion Protein
    • no

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATACCCACGCCGAAACAAG
  • 3′ sequencing primer CCTCCTTTCAGCAAAAAACCCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Ferroxidase
  • Alt name
    EncFtn
  • Species
    Rhodospirillum rubrum
  • Insert Size (bp)
    330
  • GenBank ID
    3833453
  • Promoter T7
  • Tag / Fusion Protein
    • no

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATACCCACGCCGAAACAAG
  • 3′ sequencing primer CCTCCTTTCAGCAAAAAACCCC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Material binding peptite
  • Alt name
    MBP
  • Species
    E. coli Nissle 1917
  • Insert Size (bp)
    36
  • Promoter T7
  • Tag / Fusion Protein
    • no

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATACCCACGCCGAAACAAG
  • 3′ sequencing primer CCTCCTTTCAGCAAAAAACCCC
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    Iron transporter protein
  • Alt name
    EfeU
  • Species
    E. coli Nissle 1917
  • Insert Size (bp)
    831
  • GenBank ID
    948956
  • Promoter T7
  • Tag / Fusion Protein
    • no

Cloning Information for Gene/Insert 4

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATACCCACGCCGAAACAAG
  • 3′ sequencing primer CCTCCTTTCAGCAAAAAACCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ICMAB - pET22b T7 EncFtn Mms6 was a gift from Urartu Seker (Addgene plasmid # 225538 ; http://n2t.net/addgene:225538 ; RRID:Addgene_225538)
  • For your References section:

    Engineered Bacteria with Genetic Circuits Accumulating Nanomagnets as MRI Contrast Agents. Yavuz M, Utkur M, Kehribar ES, Yagiz E, Saritas EU, Seker UOS. Small. 2022 Jul;18(26):e2200537. doi: 10.1002/smll.202200537. Epub 2022 May 13. 10.1002/smll.202200537 PubMed 35567331