Control-RB1-LRG-GFP
(Plasmid
#225875)
-
PurposeGuides targeting RB1 and a control sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225875 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLRG-EGFP
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameControl and RB1
-
gRNA/shRNA sequenceGTAATCCTAGCACTTTTAGG and GCTCTGGGTCCTCCTCAGGA
-
SpeciesH. sapiens (human)
-
Entrez GeneRB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caccattatcgtttcagaccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.06.13.495815 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Control-RB1-LRG-GFP was a gift from Janai Carr-Ascher (Addgene plasmid # 225875 ; http://n2t.net/addgene:225875 ; RRID:Addgene_225875) -
For your References section:
Genetic Screen in a Pre-Clinical Model of Sarcoma Development Defines Drivers and Therapeutic Vulnerabilities. Freeland J, Munoz M, O'Donnell E, Langerman J, Darrow M, Bergonio J, Suarez-Navarro J, Thorpe S, Canter R, Randall RL, Plath K, Carraway KL, Witte ON, Graeber TG, Carr-Ascher JR. Clin Cancer Res. 2024 Aug 23. doi: 10.1158/1078-0432.CCR-24-1238. 10.1158/1078-0432.CCR-24-1238 PubMed 39177582