Skip to main content

pET28b(+)_rPD-L1nb
(Plasmid #226715)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226715 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28b(+)
  • Backbone manufacturer
    Millipore Sigma
  • Backbone size w/o insert (bp) 5261
  • Total vector size (bp) 5702
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Recombinant PD-L1 nanobody
  • Alt name
    rPD-L1nb
  • Species
    Camelidae
  • Insert Size (bp)
    441
  • Promoter T7
  • Tags / Fusion Proteins
    • HA tag (N terminal on insert)
    • Histidine tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACCATACCCACGCCGAAACAA
  • 3′ sequencing primer CCCCTCAAGACCCGTTTAGAGGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PMID: 32051224; PDB: 5DXW

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28b(+)_rPD-L1nb was a gift from Gautam Dantas (Addgene plasmid # 226715 ; http://n2t.net/addgene:226715 ; RRID:Addgene_226715)
  • For your References section:

    A yeast-based oral therapeutic delivers immune checkpoint inhibitors to reduce intestinal tumor burden. Rebeck ON, Wallace MJ, Prusa J, Ning J, Evbuomwan EM, Rengarajan S, Habimana-Griffin L, Kwak S, Zahrah D, Tung J, Liao J, Mahmud B, Fishbein SRS, Ramirez Tovar ES, Mehta R, Wang B, Gorelik MG, Helmink BA, Dantas G. Cell Chem Biol. 2024 Nov 16:S2451-9456(24)00452-5. doi: 10.1016/j.chembiol.2024.10.013. 10.1016/j.chembiol.2024.10.013 PubMed 39571582