pAdTrack: shRev-Erbalpha
(Plasmid
#22749)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAdTrack
-
Backbone manufacturerAvailable at Addgene (#16404)
- Backbone size w/o insert (bp) 8300
-
Vector typeMammalian Expression, Adenoviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshRev-Erbalpha
-
Alt nameRev-Erbalpha
-
Alt nameRev Erb alpha
-
SpeciesM. musculus (mouse)
-
Entrez GeneNr1d1 (a.k.a. A530070C09Rik)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer n/a (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
targeting sequence: GCGCTTTGCATCGTTGTTCAA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAdTrack: shRev-Erbalpha was a gift from Bruce Spiegelman (Addgene plasmid # 22749 ; http://n2t.net/addgene:22749 ; RRID:Addgene_22749) -
For your References section:
PGC-1alpha negatively regulates hepatic FGF21 expression by modulating the heme/Rev-Erb(alpha) axis. Estall JL, Ruas JL, Choi CS, Laznik D, Badman M, Maratos-Flier E, Shulman GI, Spiegelman BM. Proc Natl Acad Sci U S A. 2009 Dec 29. 106(52):22510-5. 10.1073/pnas.0912533106 PubMed 20018698