Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAdTrack: shRev-Erbalpha
(Plasmid #22749)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 22749 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAdTrack
  • Backbone manufacturer
    Available at Addgene (#16404)
  • Backbone size w/o insert (bp) 8300
  • Vector type
    Mammalian Expression, Adenoviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    shRev-Erbalpha
  • Alt name
    Rev-Erbalpha
  • Alt name
    Rev Erb alpha
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Nr1d1 (a.k.a. A530070C09Rik, R75201)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

targeting sequence: GCGCTTTGCATCGTTGTTCAA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAdTrack: shRev-Erbalpha was a gift from Bruce Spiegelman (Addgene plasmid # 22749 ; http://n2t.net/addgene:22749 ; RRID:Addgene_22749)
  • For your References section:

    PGC-1alpha negatively regulates hepatic FGF21 expression by modulating the heme/Rev-Erb(alpha) axis. Estall JL, Ruas JL, Choi CS, Laznik D, Badman M, Maratos-Flier E, Shulman GI, Spiegelman BM. Proc Natl Acad Sci U S A. 2009 Dec 29. 106(52):22510-5. 10.1073/pnas.0912533106 PubMed 20018698