pEdit
(Plasmid
#232355)
-
PurposeThe pEdit series plasmids are derived from the pTarget series plasmids by inserting homologous recombination arms targeting the gene of interest, which enables gene knockout or gene insertion at the t
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMB1
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA
-
gRNA/shRNA sequencettgacagctagctcagtcctaggtataatactagtacgctgaaagaaacgccgcagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEdit was a gift from Yujie Cai (Addgene plasmid # 232355 ; http://n2t.net/addgene:232355 ; RRID:Addgene_232355) -
For your References section:
Construction of a CRISPR-Cas9-Based Genetic Editing Tool for Serratia marcescens Using a Stationary Phase Promoter and Its Application in Putrescine Production. Gou L, Liu D, Fan TP, Deng H, Cai Y. Biotechnol Bioeng. 2025 May;122(5):1233-1244. doi: 10.1002/bit.28949. Epub 2025 Feb 5. 10.1002/bit.28949 PubMed 39910976
