Skip to main content
Addgene

pAAV-hSyn-GRAB-HaloDA1.0
(Plasmid #234408)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234408 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GPCR activation based chemigenetic dopamine (DA) sensor GRAB_HaloDA1.0
  • Alt name
    GRAB_HaloDA1.0
  • Alt name
    HaloDA1.0
  • Species
    H. sapiens (human)
  • Promoter hSyn

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGGGCGCGACCATCTGCGC
  • 3′ sequencing primer CATTAAAGCAGCGTATCC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.12.22.629999 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-GRAB-HaloDA1.0 was a gift from Yulong Li (Addgene plasmid # 234408 ; http://n2t.net/addgene:234408 ; RRID:Addgene_234408)

  • For your References section:

    In vivo multiplex imaging of dynamic neurochemical networks with designed far-red dopamine sensors. Zheng Y, Cai R, Wang K, Zhang J, Zhuo Y, Dong H, Zhang Y, Wang Y, Deng F, Ji E, Cui Y, Fang S, Zhang X, Zhang K, Wang J, Li G, Miao X, Wang Z, Yang Y, Li S, Grimm J, Johnsson K, Schreiter E, Lavis L, Chen Z, Mu Y, Li Y. Science. 2025 Jun 5;388: 6751. doi: https://doi.org/10.1126/science.adt7705. 10.1126/science.adt7705 PubMed 39763912
Related items: