pAAV-Fon/ConN2cG
(Plasmid
#234709)
-
PurposepAAV transfer plasmid with Ef1a promoter driving Cre- and Flp-dependent expression of G protein for rabies N2c delta G
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV Ef1a
- Backbone size w/o insert (bp) 5307
- Total vector size (bp) 7478
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFon Con N2cG
-
SpeciesLyssavirus rabies
-
Insert Size (bp)2171
-
GenBank IDAAB97690.1
- Promoter Ef1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHi (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer ttggatcttggttcattctcaagcctcag
- 3′ sequencing primer aggagcaacatagttaagaataccagtcaatct
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.08.28.610136 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Fon/ConN2cG was a gift from David Ng (Addgene plasmid # 234709 ; http://n2t.net/addgene:234709 ; RRID:Addgene_234709) -
For your References section:
Segregated basal ganglia output pathways correspond to genetically divergent neuronal subclasses. Mendelsohn AI, Nikoobakht L, Bikoff JB, Costa RM. bioRxiv [Preprint]. 2024 Sep 18:2024.08.28.610136. doi: 10.1101/2024.08.28.610136. 10.1101/2024.08.28.610136 PubMed 39257765