pSB-XPRESSO-EGFP
(Plasmid
#237296)
-
PurposeSleeping Beauty XPRESSO vector for eGFP expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 237296 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 8050
- Total vector size (bp) 8850
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Insert Size (bp)717
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKowarz et al. Addgene plasmid #60513
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB-XPRESSO-EGFP was a gift from Lior Gepstein (Addgene plasmid # 237296 ; http://n2t.net/addgene:237296 ; RRID:Addgene_237296) -
For your References section:
XPRESSO: Rapid genetic engineering of human pluripotent stem cells for durable overexpression using a modular anti-silencing vector. Wexler Y, Grinstein H, Huber I, Glatstein S, Ghiringhelli M, Edri O, Landesberg M, Shiff D, Arbel G, Rosh I, Choudhary A, Stern S, Gepstein L. Stem Cell Reports. 2025 Aug 19:102603. doi: 10.1016/j.stemcr.2025.102603. 10.1016/j.stemcr.2025.102603 PubMed 40845851