Skip to main content

pSB-XPRESSO-EGFP
(Plasmid #237296)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 237296 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 8050
  • Total vector size (bp) 8850
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Insert Size (bp)
    717
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Kowarz et al. Addgene plasmid #60513

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB-XPRESSO-EGFP was a gift from Lior Gepstein (Addgene plasmid # 237296 ; http://n2t.net/addgene:237296 ; RRID:Addgene_237296)
  • For your References section:

    XPRESSO: Rapid genetic engineering of human pluripotent stem cells for durable overexpression using a modular anti-silencing vector. Wexler Y, Grinstein H, Huber I, Glatstein S, Ghiringhelli M, Edri O, Landesberg M, Shiff D, Arbel G, Rosh I, Choudhary A, Stern S, Gepstein L. Stem Cell Reports. 2025 Aug 19:102603. doi: 10.1016/j.stemcr.2025.102603. 10.1016/j.stemcr.2025.102603 PubMed 40845851