Skip to main content

AAV-U6-sgRNA-EF1a-LibVec
(Plasmid #239591)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239591 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAV-EF1a-LibVec (released on request to the manufacturer)
  • Backbone manufacturer
    D Eletto
  • Backbone size (bp) 5243
  • Vector type
    Mammalian Expression, AAV
  • Promoter hU6
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer hU6-f: GAGGGCCTATTTCCCATGATT; qPCR-gRNA-F: ttgaaaaagtggcaccgag
  • 3′ sequencing primer qPCR-EF1a-R: ttcccactcctttcaagacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-U6-sgRNA-EF1a-LibVec was a gift from Andreas Moor (Addgene plasmid # 239591 ; http://n2t.net/addgene:239591 ; RRID:Addgene_239591)
  • For your References section:

    In vivo interaction screening reveals liver-derived constraints to metastasis. Borrelli C, Roberts M, Eletto D, Hussherr MD, Fazilaty H, Valenta T, Lafzi A, Kretz JA, Guido Vinzoni E, Karakatsani A, Adivarahan S, Mannhart A, Kimura S, Meijs A, Baccouche Mhamedi F, Acar IE, Handler K, Ficht X, Platt RJ, Piscuoglio S, Moor AE. Nature. 2024 Aug;632(8024):411-418. doi: 10.1038/s41586-024-07715-3. Epub 2024 Jul 24. 10.1038/s41586-024-07715-3 PubMed 39048831