pLK06Hpp-Fab CR3009
(Plasmid
#239861)
-
PurposePlasmid for simultaneous Fab and GFP expression from separate Lac promoters for online monitoring of induction with a GFP sensor station. Fab is expressed as a fusion with alkaline phosphatase.
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 239861 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLK06Hpp
-
Backbone manufacturerLamminmäki Group, Department of Life Technologies, University of Turku
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 7439
-
Modifications to backboneVector pLK06Hpp-Fab was derived from pLK06H-Fab by inserting Lac P/O-GFP cassette into HindIII site located downstream of the Fab-alkaline phosphatase fusion gene. In this construct, the light and heavy chains of the Fab, as well as the GFP, are transcribed in the same direction.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFab (antigen binding fragment) anti-nucleocapsid protein of SARS-COV viruses 1 and 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1400
-
Entrez GeneN (a.k.a. sars9a)
-
Entrez GeneN (a.k.a. GU280_gp10)
- Promoter Lac promoter
-
Tags
/ Fusion Proteins
- bacterial alkaline phosphatase (C terminal on insert)
- Hexahistidine tag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer ccgctggattgttattactcgc
- 3′ sequencing primer agtaatatcgccctgagcag (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGFP with F64L, S65T, Q80R, M153T and V163A mutations
-
SpeciesAequorea victoria
-
Insert Size (bp)700
-
MutationF64L, S65T, Q80R, M153T and V163A
- Promoter Lac promoter
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CCGTGACGCAGTAGCGGTAAACG (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLK06Hpp-Fab CR3009 was a gift from Urpo Lamminmäki (Addgene plasmid # 239861 ; http://n2t.net/addgene:239861 ; RRID:Addgene_239861) -
For your References section:
Advancing Recombinant Antibody Production in E. coli: Optimization of Expression and Purification via Dual GFP Promoter and Imaging Technology. Korkiakoski A, Oksanen S, Huovinen T. Protein Expr Purif. 2025 Aug 28:106808. doi: 10.1016/j.pep.2025.106808. 10.1016/j.pep.2025.106808 PubMed 40885348