Skip to main content

pLK06Hpp-Fab CR3009
(Plasmid #239861)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 239861 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLK06Hpp
  • Backbone manufacturer
    Lamminmäki Group, Department of Life Technologies, University of Turku
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 7439
  • Modifications to backbone
    Vector pLK06Hpp-Fab was derived from pLK06H-Fab by inserting Lac P/O-GFP cassette into HindIII site located downstream of the Fab-alkaline phosphatase fusion gene. In this construct, the light and heavy chains of the Fab, as well as the GFP, are transcribed in the same direction.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Fab (antigen binding fragment) anti-nucleocapsid protein of SARS-COV viruses 1 and 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1400
  • Entrez Gene
    N (a.k.a. sars9a)
  • Entrez Gene
    N (a.k.a. GU280_gp10)
  • Promoter Lac promoter
  • Tags / Fusion Proteins
    • bacterial alkaline phosphatase (C terminal on insert)
    • Hexahistidine tag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer ccgctggattgttattactcgc
  • 3′ sequencing primer agtaatatcgccctgagcag
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GFP with F64L, S65T, Q80R, M153T and V163A mutations
  • Species
    Aequorea victoria
  • Insert Size (bp)
    700
  • Mutation
    F64L, S65T, Q80R, M153T and V163A
  • Promoter Lac promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CCGTGACGCAGTAGCGGTAAACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLK06Hpp-Fab CR3009 was a gift from Urpo Lamminmäki (Addgene plasmid # 239861 ; http://n2t.net/addgene:239861 ; RRID:Addgene_239861)
  • For your References section:

    Advancing Recombinant Antibody Production in E. coli: Optimization of Expression and Purification via Dual GFP Promoter and Imaging Technology. Korkiakoski A, Oksanen S, Huovinen T. Protein Expr Purif. 2025 Aug 28:106808. doi: 10.1016/j.pep.2025.106808. 10.1016/j.pep.2025.106808 PubMed 40885348