-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 24478 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3952
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSypHy
-
Alt nameRat Synaptophysin-pHluorin
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1665
-
Entrez GeneSyp (a.k.a. Syp1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site Not1 (destroyed during cloning)
- 5′ sequencing primer cctctacaaatgtggtatggc
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The depositing lab notes that the Xba1 and Bcl1 unique restriction digestion sites could be methylated and blocked if the plasmid is grown or maintained in dam+ bacteria.
Also note that in the Addgene-generated map below, the feature listed as "GFP(12-708)" is actually pH sensitive pHluorin.
There is a mutation S446T in Synaptophysin ORF. This change does not have any effect in localizing the construct to the synaptic vesicle and may be a result of a SNP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV::SypHy A4 was a gift from Leon Lagnado (Addgene plasmid # 24478 ; http://n2t.net/addgene:24478 ; RRID:Addgene_24478) -
For your References section:
Clathrin-mediated endocytosis is the dominant mechanism of vesicle retrieval at hippocampal synapses. Granseth B, Odermatt B, Royle SJ, Lagnado L. Neuron. 2006 Sep 21. 51(6):773-86. 10.1016/j.neuron.2006.08.029 PubMed 16982422