-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 24643 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepGL2-basic
- Backbone size (bp) 5597
-
Modifications to backbone3ARE + TATA box
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- Luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer LucNRev (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Took insert containing 3ARE + TATA box from A3-CAT using blunted HindIII and XhoI into pGL2-basic with a blunted EcoRI and XhoI. ARE sequence - TATCTGCTGCCCTAAAATGTGTATTCCATGGAAATGTCTGCCCTTCTCTC
NB: The A30-CAT map is attached, NOT the map for this plasmid (AR3-Lux)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAR3-Lux was a gift from Jeff Wrana (Addgene plasmid # 24643 ; http://n2t.net/addgene:24643 ; RRID:Addgene_24643)
Map uploaded by the depositor.