Skip to main content

pAR3-Lux
(Plasmid #24643)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 24643 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pGL2-basic
  • Backbone size (bp) 5597
  • Modifications to backbone
    3ARE + TATA box
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer LucNRev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Took insert containing 3ARE + TATA box from A3-CAT using blunted HindIII and XhoI into pGL2-basic with a blunted EcoRI and XhoI. ARE sequence - TATCTGCTGCCCTAAAATGTGTATTCCATGGAAATGTCTGCCCTTCTCTC

NB: The A30-CAT map is attached, NOT the map for this plasmid (AR3-Lux)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAR3-Lux was a gift from Jeff Wrana (Addgene plasmid # 24643 ; http://n2t.net/addgene:24643 ; RRID:Addgene_24643)