Skip to main content

Human CRISPR Knockout Pooled Libraries (Jacquere)
(Pooled Library #247026, #247026-LV, #247027, #247027-LV)

  • Purpose

    This is a human genome-wide CRISPR knockout library for the use of Streptococcus pyogenes Cas9. Each gene is targeted by three constructs. The design of this library is agnostic to the cell line in use.

    The Jacquere library is enriched for effective guides through prioritization of guides with strong on-target activity as predicted with the Rule Set 3 Sequence + Target Score (DeWeirdt et al., 2022 (Link opens in a new window)), strategic exclusion of guides with excessive off-target activity, and avoidance of target sites with high variant frequencies in the human population according to the gnomAD (Link opens in a new window) database. Further, Jacquere is designed against current gene annotations sourced from GENCODE (v47), RefSeq (v2024_08), and CHESS (v3.1.3), thereby offering coverage of the comprehensive and contemporary human genome.

    Pooled library #247026 is a split-vector (two-vector) library, with Cas9 and gRNAs supplied on different plasmids. Pooled library #247027 is an all-in-one (one-vector) library, with Cas9 and gRNAs on the same plasmid.

  • Vector Backbone

    Pooled Library #247026 (two-vector system): pMV_AA050 (Plasmid #216107) - does not express Cas9

    Pooled Library #247027 (one-vector system): pRDA_734 (Plasmid #216097) - expresses Cas9

Ordering

Item Catalog # Description Quantity Price (USD)
Pooled Library 247026 Human CRISPR KO Library in pMV_AA050 1 $642 Add to Cart
Lentiviral Prep 247026-LV Virus (1.3×108 TU, titer ≥ 1×107 TU/mL)
and Pooled Library DNA More Information
1 $3572 Add to Cart
Pooled Library 247027 Human CRISPR KO Library in pRDA_734 1 $642 Add to Cart
Lentiviral Prep 247027-LV Virus (1.3×108 TU, titer ≥ 5×106 TU/mL)
and Pooled Library DNA More Information
1 $3572 Add to Cart
Available to Academic and Nonprofits Only
  • A Cas9 plasmid is NOT included with this item and will have to be ordered separately. Can be used in conjunction with pMV_AA088 (Addgene #216104) or any other plasmid(s) or cell lines expressing Cas9.

Library Details

  • Species
    Human
  • Genes targeted
    20,550
  • gRNAs per gene
    3
  • Total gRNAs
    60,550
  • Controls
    900 intergenic-targeting, 100 non-targeting
  • Lentiviral generation
    3rd

Library Shipping

Each library is delivered in a microcentrifuge tube on blue ice. The tube's contents will not necessarily be frozen. For best results, minimize freeze/thaws.

  • Volume
    ∼25 µL
  • Concentration
    50 ng/µL

Resource Information

Depositor Comments

Deconvolution algorithms for analyzing NGS data: Extract guide sequences from sequencing reads by running PoolQ with the search prefix “CACCG”, and count reads by alignment to a reference file of all possible guides present in the library.

Table column headings denote the source catalog of the genes: Total, GENCODE v47, RefSeq 08-2024, CHESS 3.1.3. The top row denotes number targeted by more than three guides: 2177, 2177, 0, 0. The next row denotes number targeted by 3 guides: 18235, 17709, 508, 18. The next row denotes number targeted by 2 guides: 88, 68, 20, 0. The next row denotes number targeted by 1 guide: 50, 31, 19, 0. The last row denoted the number not targetable: 162, 126, 40, 0.
Figure 1: Genes targeted in Jacquere, stratified by source catalog.

Please visit https://doi.org/10.1101/2025.08.26.672375 (Link opens in a new window) for bioRxiv preprint.

Information for Lentiviral Prep (Catalog # 247026-LV, Two-vector system) ( Back to top )

Purpose

Ready-to-use lentiviral pooled library for CRISPR screening in human cells. Contains 60,550 sgRNAs, targeting 20,550 genes. Lentiviral particles carrying Jacquere human CRISPR sgRNA knockout library in pMV_AA050.

Delivery

  • Volume Varies depending on titer.
  • Titer ≥ 1 × 107 TU/mL
  • Storage Store at -80 °C. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Pooled Library DNA (20 µL at 50 ng/µL) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPRO SFM
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Pooled Library Representation:
  • To confirm library representation and distribution, we perform next-generation sequencing on the purified plasmid DNA pool that was used to generate lentivirus.

Titering Method:
  • ddPCR: 293T cells are transduced with serial dilutions of 247026-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.
PCR confirmation of insert:
  • PCR was carried out with primers targeting the U6 and EF1-alpha promoters. The PCR product was visualized on an agarose gel for size confirmation.
    • Forward primer: GAGGGCCTATTTCCCATGATT
    • Reverse Primer: CACGGCGACTACTGCACTTA

Visit our viral production page for more information.

Addgene Comments

Shipment specifications:

Pooled libraries containing at least 1.3 × 108 infectious units are shipped on dry ice at a titer of ≥ 1 × 107 TU/mL. The total volume is divided among several large aliquots and one 1.3 mL aliquot for testing. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to use this virus:

We recommend using the testing aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in the original publication. Before using this virus, Addgene strongly recommends reading the original publication (Drepanos et al., 2025 (Link opens in a new window)).

A brief and partial description of how to use this virus:

  1. Start by optimizing the infection conditions in your cell line in order to achieve 30–50% infection efficiency, corresponding to a multiplicity of infection (MOI) of ~0.5–1. Infect 2.5 × 106 suspension (or 3 × 106 adherent) cells in each well of a 12-well dish at different MOIs. Determine which condition yields a 30–50% infection efficiency, and note the infection efficiency for this condition.

  2. The Jacquere CRISPR knockout pooled library has 60,550 gRNAs. To achieve the recommended representation of ~400 cells per sgRNA, a total of ~2.42 × 107 infected cells is needed. Calculate the number of cells on which to perform the infection by considering the infection efficiency noted in the optimized condition. For example, if the infection efficiency is 50%, perform the infection on 4.84 × 107 cells to ultimately achieve 3.06 × 107 infected cells.

  3. Perform the screening-scale infection with the pre-determined MOI in the same 12-well format as the optimized condition. Briefly, infect 2.5 × 106 suspension (or 3 × 106 adherent) cells in each well of a 12-well dish. Scale up the number of wells to achieve the desired total number of cells.

  4. Based on a screening MOI of 0.5–1 and the total number of cells infected, Addgene estimates that 3–10 mL of virus will be needed to perform the screen. An additional 1 mL of virus will be needed to perform the optimization. Based on the infection efficiency observed in each cell line, these estimates are subject to variation. Not every cell type is infectable under these conditions, and Addgene recommends that infectability of cells be determined empirically.

How to use the virus associated DNA:

Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

  • This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in the original publication (Drepanos et al., 2025 (Link opens in a new window)), perform screen analysis by determining the log2-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014 (Link opens in a new window)).

  • The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Amplification Protocol for more information.

Information for Lentiviral Prep (Catalog # 247027-LV, One-vector system) ( Back to top )

Purpose

Ready-to-use lentiviral pooled library for CRISPR screening in human cells. Contains 60,550 sgRNAs, targeting 20,550 genes. Lentiviral particles carrying Jacquere human CRISPR sgRNA knockout library in pRDA_734.

Delivery

  • Volume Varies depending on titer.
  • Titer ≥ 5 × 106 TU/mL
  • Storage Store at -80 °C. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Pooled Library DNA (20 µL at 50 ng/µL) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPRO SFM
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Pooled Library Representation:
  • To confirm library representation and distribution, we perform next-generation sequencing on the purified plasmid DNA pool that was used to generate lentivirus.

Titering Method:
  • ddPCR: 293T cells are transduced with serial dilutions of 247027-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.
PCR confirmation of insert:
  • PCR was carried out with primers targeting the Cas9 and P2A. The PCR product was visualized on an agarose gel for size confirmation.
    • Forward primer: AGAGCAGGCCGAGAATATCA
    • Reverse Primer: ACATCTCCGGCTTGTTTCAG

Visit our viral production page for more information.

Addgene Comments

Shipment specifications:

Pooled libraries containing at least 1.3 × 108 infectious units are shipped on dry ice at a titer of ≥ 5 × 106 TU/mL. The total volume is divided among several large aliquots and one 1.3 mL aliquot for testing. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to use this virus:

We recommend using the testing aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in the original publication. Before using this virus, Addgene strongly recommends reading the original publication (Drepanos et al., 2025 (Link opens in a new window)).

A brief and partial description of how to use this virus:

  1. Start by optimizing the infection conditions in your cell line in order to achieve 30–50% infection efficiency, corresponding to a multiplicity of infection (MOI) of ~0.5–1. Infect 2.5 × 106 suspension (or 3 × 106 adherent) cells in each well of a 12-well dish at different MOIs. Determine which condition yields a 30–50% infection efficiency, and note the infection efficiency for this condition.

  2. The Jacquere CRISPR knockout pooled library has 60,550 gRNAs. To achieve the recommended representation of ~400 cells per sgRNA, a total of ~2.42 × 107 infected cells is needed. Calculate the number of cells on which to perform the infection by considering the infection efficiency noted in the optimized condition. For example, if the infection efficiency is 50%, perform the infection on 4.84 × 107 cells to ultimately achieve 3.06 × 107 infected cells.

  3. Perform the screening-scale infection with the pre-determined MOI in the same 12-well format as the optimized condition. Briefly, infect 2.5 × 106 suspension (or 3 × 106 adherent) cells in each well of a 12-well dish. Scale up the number of wells to achieve the desired total number of cells.

  4. Based on a screening MOI of 0.5–1 and the total number of cells infected, Addgene estimates that 3–10 mL of virus will be needed to perform the screen. An additional 1 mL of virus will be needed to perform the optimization. Based on the infection efficiency observed in each cell line, these estimates are subject to variation. Not every cell type is infectable under these conditions, and Addgene recommends that infectability of cells be determined empirically.

How to use the virus associated DNA:

Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

  • This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in the original publication (Drepanos et al., 2025 (Link opens in a new window)), perform screen analysis by determining the log2-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014 (Link opens in a new window)).

  • The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Amplification Protocol for more information.

How to cite this pooled library ( Back to top )

These pooled libraries were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human CRISPR Knockout Pooled Library (Jacquere) split-vector was a gift from John Doench and David Root (Addgene #247026 ; http://n2t.net/addgene:247026 ; RRID:Addgene_247026)
    Human CRISPR Knockout Pooled Library (Jacquere) all-in-one was a gift from John Doench and David Root (Addgene #247027 ; http://n2t.net/addgene:247027 ; RRID:Addgene_247027)
  • For your References section:

    Balancing off-target and on-target considerations for optimized CRISPR-Cas9 knockout library design. Drepanos LM, Srikanth S, Kaplan EG, Shah ST, Velasco BE, Merzouk S, Doench JG. Cell Genom. 2026 May 13;6(5):101190. doi: 10.1016/j.xgen.2026.101190. PubMed