-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 24706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUNIV
- Backbone size w/o insert (bp) 5695
-
Vector typeMammalian Expression, Bacterial Expression, Yeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsany standard
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
SpeciesAequoria victoria
-
Insert Size (bp)720
-
Entrez GeneeGFP (a.k.a. pPRS3a_01)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer TATGTAGCTTAGAGACTCCATTCGGGTGTTC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUNIV-EGFP was a gift from Cynthia Czajkowski (Addgene plasmid # 24706 ; http://n2t.net/addgene:24706 ; RRID:Addgene_24706) -
For your References section:
Optimized expression vector for ion channel studies in Xenopus oocytes and mammalian cells using alfalfa mosaic virus. Venkatachalan SP, Bushman JD, Mercado JL, Sancar F, Christopherson KR, Boileau AJ. Pflugers Arch. 2007 Apr . 454(1):155-63. 10.1007/s00424-006-0183-1 PubMed 17146677