Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pUNIV-EGFP
(Plasmid #24706)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 24706 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUNIV
  • Backbone size w/o insert (bp) 5695
  • Vector type
    Mammalian Expression, Bacterial Expression, Yeast Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    any standard
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Species
    Aequoria victoria
  • Insert Size (bp)
    720
  • Entrez Gene
    eGFP (a.k.a. pPRS3a_01)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer TATGTAGCTTAGAGACTCCATTCGGGTGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUNIV-EGFP was a gift from Cynthia Czajkowski (Addgene plasmid # 24706 ; http://n2t.net/addgene:24706 ; RRID:Addgene_24706)
  • For your References section:

    Optimized expression vector for ion channel studies in Xenopus oocytes and mammalian cells using alfalfa mosaic virus. Venkatachalan SP, Bushman JD, Mercado JL, Sancar F, Christopherson KR, Boileau AJ. Pflugers Arch. 2007 Apr . 454(1):155-63. 10.1007/s00424-006-0183-1 PubMed 17146677