Skip to main content

pUNIV-EGFP
(Plasmid #24706)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 24706 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 24706-D50 50 μg of DNA in Tris buffer $495
DNA 24706-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUNIV
  • Backbone size w/o insert (bp) 5695
  • Vector type
    Mammalian Expression, Bacterial Expression, Yeast Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    any standard
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Species
    Aequoria victoria
  • Insert Size (bp)
    720
  • Entrez Gene
    eGFP (a.k.a. pPRS3a_01)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer TATGTAGCTTAGAGACTCCATTCGGGTGTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUNIV-EGFP was a gift from Cynthia Czajkowski (Addgene plasmid # 24706 ; http://n2t.net/addgene:24706 ; RRID:Addgene_24706)
  • For your References section:

    Optimized expression vector for ion channel studies in Xenopus oocytes and mammalian cells using alfalfa mosaic virus. Venkatachalan SP, Bushman JD, Mercado JL, Sancar F, Christopherson KR, Boileau AJ. Pflugers Arch. 2007 Apr . 454(1):155-63. 10.1007/s00424-006-0183-1 PubMed 17146677