Skip to main content

pCerulean
(Plasmid #24756)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 24756 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pALC2084
  • Backbone manufacturer
    Ambrose Cheung
  • Backbone size w/o insert (bp) 6500
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Chloramphenicol in S. aureus
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cerulean
  • Species
    synthetic
  • Insert Size (bp)
    720

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ctaatgcgctgttaatcactttac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    derived from cpGFP1 by Maureen Hanson (NY, USA); cite: Reed, M.L., Wilson, S.K., Sutton, C.A. and Hanson, M.R. (2001). High-level expression of a synthetic red-shifted GFP coding region incorporated into transgenic chloroplasts. Plant J 27, 257-265.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCerulean was a gift from Martin Fraunholz (Addgene plasmid # 24756 ; http://n2t.net/addgene:24756 ; RRID:Addgene_24756)
  • For your References section:

    Codon-improved fluorescent proteins in investigation of Staphylococcus aureus host pathogen interactions. Paprotka K, Giese B, Fraunholz MJ. J Microbiol Methods. 2010 Oct;83(1):82-6. doi: 10.1016/j.mimet.2010.07.022. Epub 2010 Aug 11. 10.1016/j.mimet.2010.07.022 PubMed 20708040