-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 24756 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepALC2084
-
Backbone manufacturerAmbrose Cheung
- Backbone size w/o insert (bp) 6500
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsChloramphenicol in S. aureus
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCerulean
-
Speciessynthetic
-
Insert Size (bp)720
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ctaatgcgctgttaatcactttac (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byderived from cpGFP1 by Maureen Hanson (NY, USA); cite: Reed, M.L., Wilson, S.K., Sutton, C.A. and Hanson, M.R. (2001). High-level expression of a synthetic red-shifted GFP coding region incorporated into transgenic chloroplasts. Plant J 27, 257-265.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCerulean was a gift from Martin Fraunholz (Addgene plasmid # 24756 ; http://n2t.net/addgene:24756 ; RRID:Addgene_24756) -
For your References section:
Codon-improved fluorescent proteins in investigation of Staphylococcus aureus host pathogen interactions. Paprotka K, Giese B, Fraunholz MJ. J Microbiol Methods. 2010 Oct;83(1):82-6. doi: 10.1016/j.mimet.2010.07.022. Epub 2010 Aug 11. 10.1016/j.mimet.2010.07.022 PubMed 20708040