-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 24794 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3950
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLck-GCaMP2
-
Alt nameGCaMP
-
Alt nameGCaMP2
-
Alt nameLck-GCaMP
-
Insert Size (bp)1480
-
MutationPlasmid contains N-terminal 26 amino acid membrane targeting sequence of Lck (Src tyrosine kinase) fused to GCaMP2. 6xHis and Xpress (FLAG-like) epitope tags contained within 'RSET' sequence, making up the linker region between Lck and GCaMP2
-
Tags
/ Fusion Proteins
- His
- Xpress
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACGGTGGGAGGTCTATATAAGCAGAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byA. Sagasti (UCLA) for the GCaMP2 plasmid and D.E. Bergles (Johns Hopkins) for the Lck domain containing plasmid.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN1-Lck-GCaMP2 was a gift from Baljit Khakh (Addgene plasmid # 24794 ; http://n2t.net/addgene:24794 ; RRID:Addgene_24794) -
For your References section:
A genetically targeted optical sensor to monitor calcium signals in astrocyte processes. Shigetomi E, Kracun S, Sofroniew MV, Khakh BS.. Nat Neurosci. 2010 Jun;13(6):759-66. 10.1038/nn.2557 PubMed 20495558