pSICO-Flpo
(Plasmid #24969)

• Depositing Lab: Tyler Jacks
• Publication: Young et al Proc Natl Acad Sci U S A. 2010 Jun 1. 107(22):10184-9.

Backbone

• Vector backbone: pSico
• Backbone manufacturer: Addgene Plasmid 11578
• Backbone size w/o insert (bp): 6739
• Vector type: Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Flp recombinase
• Insert Size (bp): 1300

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: StuI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: mPGK-F
• 3′ sequencing primer: WPRE-R (CATAGCGTAAAAGGAGCAACA)

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pSico-Flpo allows for conditional (Cre-Lox), stable expression of shRNAs for RNA interference in cells and transgenic mice. Addition of Cre TURNS ON shRNA expression.
The shRNA coding oligos have to be cloned into the HpaI and XhoI restriction sites. Oligo design information can be found on the author's map or on the Jacks Lab website http://web.mit.edu/ccr/labs/jacks/protocols/pSico.html