-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 24969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSico
-
Backbone manufacturerAddgene Plasmid 11578
- Backbone size w/o insert (bp) 6739
-
Vector typeMammalian Expression, Lentiviral, RNAi, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlp recombinase
-
Insert Size (bp)1300
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site StuI (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer mPGK-F
- 3′ sequencing primer WPRE-R (CATAGCGTAAAAGGAGCAACA) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pSico-Flpo allows for conditional (Cre-Lox), stable expression of shRNAs for RNA interference in cells and transgenic mice. Addition of Cre TURNS ON shRNA expression.
The shRNA coding oligos have to be cloned into the HpaI and XhoI restriction sites. Oligo design information can be found on the author's map or on the Jacks Lab website http://web.mit.edu/ccr/labs/jacks/protocols/pSico.html
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSICO-Flpo was a gift from Tyler Jacks (Addgene plasmid # 24969 ; http://n2t.net/addgene:24969 ; RRID:Addgene_24969) -
For your References section:
Tissue-specific p19Arf regulation dictates the response to oncogenic K-ras. Young NP, Jacks T. Proc Natl Acad Sci U S A. 2010 Jun 1. 107(22):10184-9. 10.1073/pnas.1004796107 PubMed 20479239