-
PurposeControl lentiviral vector with Tet-based inducible expression of Luciferase miR30-based shRNA and GFP, constitutive Neomycin resistance gene coexpression.
-
Depositing Lab
-
Depositing OrganizationCalifornia Institute of Technology
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 25745 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSLIK
-
Backbone manufacturerIain Fraser
- Backbone size w/o insert (bp) 13217
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Growth instructionsTop10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLuciferase miR-shRNA
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BfuA1 (not destroyed)
- 3′ cloning site BfuA1 (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer Neo-R, hUBCpro-R
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byrtTA- Atze Das, University of Amsterdam; TRE promoter- David Anderson, Caltech; miR30- Greg Hannon, CSHL
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lentivirus; Inducible TRE driven GFP-shRNA; Constitutive Ubi-c driven rtTA3-IRES-Neo
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK-Neo-TGmiR-Luc was a gift from Iain Fraser (Addgene plasmid # 25745 ; http://n2t.net/addgene:25745 ; RRID:Addgene_25745) -
For your References section:
A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 PubMed 16945906