pLL3.7_hsa-miR-30c
(Plasmid
#25797)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 25797 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLL3.7
- Backbone size w/o insert (bp) 7650
-
Vector typeLentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehsa-miR-30c
-
Alt namemiR-30c
-
SpeciesH. sapiens (human)
-
Insert Size (bp)210
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe pLL3.7 cassette containing the U6 promoter and a control short hairpin was replaced by a cassette containing the U6 promoter and an approx 300 bp genomic fragment for expression of the mature miRNA from pSIREN-RetroQ-miRNA expression vectors, kindly provided by Dr. B. Ramratnam, Brown University
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
miR-30c sequence: 5'TGTAAACATCCTACACTCTCAGC3'
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLL3.7_hsa-miR-30c was a gift from Judy Lieberman (Addgene plasmid # 25797 ; http://n2t.net/addgene:25797 ; RRID:Addgene_25797) -
For your References section:
miR-34a contributes to megakaryocytic differentiation of K562 cells independently of p53. Navarro F, Gutman D, Meire E, Caceres M, Rigoutsos I, Bentwich Z, Lieberman J. Blood. 2009 Sep 3. 114(10):2181-92. 10.1182/blood-2009-02-205062 PubMed 19584398